البصمة الوراثية (DNA Profiling)

البصمة الوراثية
د. محمد مجدي
٠٤‏/٠٧‏/٢٠١٩

يتكون المحتوى الوراثي (Genome) من مادة كيميائية هي الحمض النووي (DNA).

الحمض النووي (DNA) هو الحمض النووي الريبوزي منزوع الأوكسجين، وهو عبارة عن جزيء ضخم يحتوي على الشفرة الوراثية المميزة لكل شخص، ويحتوي على التعليمات اللازمة للكائن الحي لكي ينمو، ويعيش، ويتكاثر، ولكي يقوم بهذه الوظائف فإن تتابع جزيئات الحمض النووي يتحول إلى رسائل لإنتاج البروتين الذي يقوم بأغلب الوظائف داخل الجسم. ويتكون الحمض النووي من شريطين يلتفان حول بعضهما على هيئة لولب مزدوج، أو سلم ملتوٍ.

يوجد الحمض النووي في جميع الخلايا الحية والميتة في جسم الإنسان، ويتركز في نواة الخلية، وينتقل من الآباء إلى الأبناء، حيث أنه في عملية التكاثر يتكون الحمض النووي للابن من 50% من الحمض النووي من الأب، و50% من الحمض النووي للأم.

يتكون الحمض النووى من وحدات بناء كيميائية تسمى النيوكليوتيدات، تتكون هذه النيوكليوتيدات من ثلاثة أجزاء: مجموعة فوسفات، ومجموعة سكر، وواحدة من أربع قواعد نيتروجينية، هي:(A) الأدينين، و(T) الثايمين، و(G) الجوانين، و(C) السيتوزين. ويحكم ترتيب هذه القواعد الشفرة الوراثية.

ما هي البصمة الوراثية؟

البصمة الوراثية هي سلسلة من الاختبارات والتقنيات التي تستخدم لتقييم وتحديد المعلومات الجينية المتواجدة في خلايا شخص معين، أما في الطب الشرعي فيتم تعريفها بأنها مقارنة بين المعلومات الجينية لشخص معين وبين دليل وجد في مسرح الجريمة.

على الرغم من أن الحمض النووي (DNA) متطابق لدى جميع الناس بنسبة 99.9%، إلا أن هناك بعض المناطق المعينة التي تختلف تماما ما بين شخص وآخر، وهذه المناطق تدعى مناطق متعددة الأشكال.

يمكن تحليل الحمض النووي متعدد الأشكال ليعطي البصمة الوراثية.

ومن المثير للاهتمام معرفة أن نسبة تطابق البصمة الوراثية بين شخصين (ليسا أخوين متطابقين) تكاد تكون معدومة.

تاريخ البصمة الوراثية

تم التعرف على البصمة الوراثية عن طريق عالم الوراثة الإنجليزي أليك جيفريز، الأستاذ بجامعة ليستر الإنجليزية عام 1984، عندما نشر بحثا يقول فيه أن التتابعات المكونة للمادة الوراثية لا يمكن أن تتشابه بين اثنين في العالم (إلا في حالة التوائم المتطابقة)، وأن احتمال تشابه البصمة الوراثية بين شخص وآخر هو واحد في التريليون.

التقنيات المستخدمة في البصمة الوراثية

تسمى إحدى أحدث التقنيات لعمل البصمة الوراثية باستخدام تفاعل البوليميراز المتسلسل (PCR) تسمى التكرارات المزدوجة القصيرة (Short Tandem Repeats) وتعرف اختصارا بـ (STR).

التكرارات المزدوجة القصيرة (STR) هي مناطق من الحمض النووي تحتوي على تكرارات لنفس تسلسل النيوكليوتيدات.

على سبيل المثال،GATAGATAGATAGATAGATAGATA هو نموذج لتكرارات مزدوجة قصيرة يتكرر تتابع النيوكليوتيد GATA ست مرات.

توجد هذه التكرارات المزدوجة القصيرة في مواقع جينية في الحمض النووي.

خطوات الحصول على البصمة الوراثية

يوجد خمس خطوات للحصول على البصمة الوراثية باستخدام تقنية التكرارات المزدوجة القصيرة (STR):

  • الحصول على عينة من الحمض النووي (DNA): يوجد الحمض النووي في معظم خلايا الجسم، لذلك يمكن الحصول عليه من خلايا الدم، أو السائل المنوي، أو اللعاب، أو خصلات الشعر، ويمكن الحصول على هذه العينة من مسرح الجريمة في حالة وقوع جرائم، أو من الأشخاص المشتبه بهم.
  • استخراج الحمض النووي: يوجد الحمض النووي داخل نواة الخلية، لذلك تتم إضافة بعض المواد الكيميائية لاقتحام الخلية، واستخراج الحمض النووي، وعزله عن باقي مكونات الخلية.
  • نسخ الحمض النووي: يوجد غالبا كميات ضئيلة من الحمض النووي أثناء إجراء تحليل الطب الشرعي، لذلك فإن التكرارات المزدوجة القصيرة (STR) يتم نسخها مرات عديدة باستخدام (PCR) للحصول على كمية كافية من الحمض النووي، تكفي للحصول على البصمة الوراثية.
  • تحديد حجم التكرارات المزدوجة القصيرة: يتم تحديد حجم التكرارات المزدوجة القصيرة باستخدام التحليل الجيني، حيث يفصل التحليل الجيني الحمض النووي المنسوخ باستخدام الفصل الكهربائي، ويتم تحديد التكرارات المزدوجة القصيرة باستخدام صبغة الفلورسنت.
  • التطابق: يتم استخدام حجم التكرارات المزدوجة القصيرة، لمعرفة عدد المرات التي تكرر فيها تتابع النيوكليوتيدات، وبعد ذلك تتم المقارنة مع عينة أخرى، وإذا حدث تطابق بين العينتين، فإنهما يكونان لنفس الشخص.

تطبيقات البصمة الوراثية

حيث أن لكل شخص بصمة وراثية مميزة، لا يمكن أن تتشابه مع أي شخص آخر، فإنه يمكن استخدام البصمة الوراثية في ما يلي:

  • تحديد الأشخاص في حالة وقوع جرائم، حيث يمكن الحصول على عينة من مسرح الجريمة، مثل نقطة دم، أو خصلة شعر، أو لعاب، ويتم عمل البصمة الوراثية لهذه العينة، ومطابقتها مع البصمة الوراثية الخاصة بالمشتبه بهم، أو مطابقتها بالبصمات الوراثية الموجودة في قاعدة البيانات الموجودة لدى الشرطة.
  • إثبات النسب أو نفيه، حيث تتم مطابقة البصمة الوراثية مع كل من الابن والأب أو الأم.
  • معرفة هوية الضحايا في حالات الكوارث الطبيعية، مثل الفيضانات، والزلازل، والحرائق حيث تتم مطابقة البصمة الوراثية للضحايا مع البصمة الوراثية الخاصة بذويهم.

كيف يتم حفظ البصمة الوراثية؟

تعد المملكة المتحدة أول دولة تنشئ قاعدة بيانات قومية خاصة بالبصمة الوراثية عام 1995، وتحتوي هذه القاعدة على البصمة الوراثية لأشخاص، أغلبهم يرتبط بجرائم خطيرة.

تمتلك أغلب الدول الأوروبية حاليا قاعدة بيانات قومية خاصة بالبصمة الوراثية.


المراجع:

Genome. DNA (Deoxyribonucleic Acid). Retrieved on the 16th of June, 2019, from:

https://www.genome.gov/genetics-glossary/Deoxyribonucleic-Acid

sciencelearn. DNA Profiling. Retrieved on the 16th of June, 2019, from:

https://www.sciencelearn.org.nz/resources/1980-dna-profiling

Yourgenome. What is a DNA fingerprint? Retrieved on the 16th of June, 2019, from:

https://www.yourgenome.org/facts/what-is-a-dna-fingerprint

تاريخ الإضافة: | تاريخ التعديل: 2019-07-07 15:14:57 | Article View: 1246


شارك المقال مع أصدقائك

هل تريد التحدث مع طبيب الآن؟
Altibbi